Contents 1.Introduction 2. Materials and equipment 3. Procedure 4. Results 5. Precautions 6. References |
1. Introduction
1. Introduction
This protocol can explore the basic principle and procedures of PCR using genomic DNA of Lambda Phage
Three different primer sets are used to amplify three parts of Lambda Phage genome
and to distinguish DNA fragment by its size (the length of sequence).
2.Materials and equipment
2. Materials and equipment
Materials
DNA Polymerase 2X Master mix, Primer set 1, 2, 3
Lambda Genomic DNA, dH2O , DNA Ladder(100bp)
> Sequence of primer 1, primer 2 and primer 3 used in this experiment
P1_F: GAAGCGTTTATGCGGAAGAG
P1_R: CGTTGCGTTTGTTTGCAC
P2_F: GAAGCGTTTATGCGGAAGAG
P2_R: ACCTGCTGATCTGCGACTTA
P3_F: GAAGCGTTTATGCGGAAGAG
P3_R: TGACTCCTGTTGATAGATCCAGT
Equipment
Conventional PCR (DuxCycler - Biomedux Co., Ltd., Korea)
Gel Electrophoresis (DuxGeldoc - Biomedux Co., Ltd., Korea)
3. Procedure
3. Procedure
1) Sample Preparation
| Sample 1 | Sample 1 | Sample 1 | Sample 1 |
|---|
| 2X Master Mix | 10uL | 10uL | 10uL | 10uL |
| Primer Set | P1: 4uL | P2: 4uL | P3: 4uL | - |
| Lambda DNA | 3uL | 3uL | 3uL | 3uL |
| dH2O | 3uL | 3uL | 3uL | 7uL |
| Total | 20uL | 20uL | 20uL | 20uL |
2) PCR condition
| Stage | Temperature | Time | Repeat cycle |
|---|
| Initial denaturation* | 95℃ | 05:00 | 1 |
| Denaturation | 95℃ | 00:30 | 30 |
| Annealing | 58℃ | 00:30 |
| Extension | 72℃ | 01:00 |
| Final Extension | 72℃ | 05:00 | 1 |
| 4℃** | ∞ |
|
* The sufficient initial denaturation time of about 5 minutes ensure for complete denaturation of target DNA. If the denaturation is not sufficient, annealing and extension processes might be interrupted, and exact PCR outcome could not be obtained. It is also recommended having sufficient initial extension time for about 5 minutes with the same reason.
** At this temperature, PCR outcome can be most stably maintained without denaturation for storage.
3) Confirmation of PCR outcome with Gel electrophoresis
3-1) Preparation of agarose gel
① Put 0.5X TBE buffer and agarose powder in Erlenmeyer flask and mix them well.
| Size range of DNA samples | Concentration of agarose (w/v) | TAE buffer | Agarose |
|---|
| 1kb ~ 30kb | 0.5% | 20mL | 0.10g |
| 800bp ~ 12kb | 0.7% | 20mL | 0.14g |
| 500bp ~ 10kb | 1.0% | 20mL | 0.20g |
| 400bp ~ 7kb | 1.2% | 20mL | 0.24g |
| 200bp ~ 3kb | 1.5% | 20mL | 0.30g |
| 50bp ~ 2kb | 2.0% | 20mL | 0.40g |
[Concentration of agarose depending on DNS sizes]
② Put the Erlenmeyer flask in the microwave and operate it for about 1 to 2 minutes to completely dissolve powder.
③ Insert comb (for casting the loading points of samples and ladder) to the gel plate and pour dissolved agarose.
4. Results
4. Results
M 1 2 3 4 M
| Lane |
|
|---|
| M | 100bp DNA Ladder |
| 1 | PCR outcome of Primer set 1 (202bp) |
| 2 | PCR outcome of Primer set 2 (304bp) |
| 3 | PCR outcome of Primer set 3 (501bp) |
| 4 | Negative Control |
▲ Example image of gel electrophoresis of the PCR outcome (Taken by: DuxGeldoc - Biomedux Co., Ltd.)
5. Precautions
5. Precautions
- Cleaning apparatus and table using disinfectant solution in order to remove contaminants.
- One target primer should be put in one PCR tube for ensuring an accurate experiment.
6. References
6. References
#PCR #Conventional PCR #Lambda Phage #DNA #Nucleic Acid Amplification #Electrophoresis
Contents
1.Introduction
2. Materials and equipment
3. Procedure
4. Results
5. Precautions
6. References
1. Introduction
1. Introduction
This protocol can explore the basic principle and procedures of PCR using genomic DNA of Lambda Phage
Three different primer sets are used to amplify three parts of Lambda Phage genome
and to distinguish DNA fragment by its size (the length of sequence).
2.Materials and equipment
2. Materials and equipment
Materials
DNA Polymerase 2X Master mix, Primer set 1, 2, 3
Lambda Genomic DNA, dH2O , DNA Ladder(100bp)
> Sequence of primer 1, primer 2 and primer 3 used in this experiment
P1_F: GAAGCGTTTATGCGGAAGAG
P1_R: CGTTGCGTTTGTTTGCAC
P2_F: GAAGCGTTTATGCGGAAGAG
P2_R: ACCTGCTGATCTGCGACTTA
P3_F: GAAGCGTTTATGCGGAAGAG
P3_R: TGACTCCTGTTGATAGATCCAGT
Gel Electrophoresis (DuxGeldoc - Biomedux Co., Ltd., Korea)
3. Procedure
3. Procedure
1) Sample Preparation
2) PCR condition
* The sufficient initial denaturation time of about 5 minutes ensure for complete denaturation of target DNA. If the denaturation is not sufficient, annealing and extension processes might be interrupted, and exact PCR outcome could not be obtained. It is also recommended having sufficient initial extension time for about 5 minutes with the same reason.
** At this temperature, PCR outcome can be most stably maintained without denaturation for storage.
3) Confirmation of PCR outcome with Gel electrophoresis
3-1) Preparation of agarose gel
① Put 0.5X TBE buffer and agarose powder in Erlenmeyer flask and mix them well.
[Concentration of agarose depending on DNS sizes]
② Put the Erlenmeyer flask in the microwave and operate it for about 1 to 2 minutes to completely dissolve powder.
③ Insert comb (for casting the loading points of samples and ladder) to the gel plate and pour dissolved agarose.
4. Results
4. Results
M 1 2 3 4 M
▲ Example image of gel electrophoresis of the PCR outcome (Taken by: DuxGeldoc - Biomedux Co., Ltd.)
5. Precautions
5. Precautions
6. References
6. References
#PCR #Conventional PCR #Lambda Phage #DNA #Nucleic Acid Amplification #Electrophoresis