[PCR]#1 PCR Protocol for Lambda phage DNA

관리자
25 Jun 2021
Views 73

Contents

1.Introduction

2. Materials and equipment

3. Procedure

4. Results

5. Precautions

6. References

1. Introduction 


1. Introduction

This protocol can explore the basic principle and procedures of PCR using genomic DNA of Lambda Phage

Three different primer sets are used to amplify three parts of Lambda Phage genome

and to distinguish DNA fragment by its size (the length of sequence).

2.Materials and equipment 


2. Materials and equipment 

Materials

DNA Polymerase 2X Master mix, Primer set 1, 2, 3

Lambda Genomic DNA, dH2O , DNA Ladder(100bp)

 

> Sequence of primer 1, primer 2 and primer 3 used in this experiment

P1_F: GAAGCGTTTATGCGGAAGAG

P1_R: CGTTGCGTTTGTTTGCAC


P2_F: GAAGCGTTTATGCGGAAGAG

P2_R: ACCTGCTGATCTGCGACTTA


P3_F: GAAGCGTTTATGCGGAAGAG

P3_R: TGACTCCTGTTGATAGATCCAGT


Equipment
Conventional PCR (DuxCycler - Biomedux Co., Ltd., Korea)

Gel Electrophoresis (DuxGeldoc - Biomedux Co., Ltd., Korea)

3. Procedure


3. Procedure

1) Sample Preparation


Sample 1Sample 1Sample 1Sample 1
2X Master Mix10uL10uL10uL10uL
Primer SetP1: 4uLP2: 4uLP3: 4uL-
Lambda DNA3uL3uL3uL3uL
dH2O3uL3uL3uL7uL
Total20uL20uL20uL20uL


2) PCR condition

StageTemperatureTimeRepeat cycle
Initial denaturation*95℃05:001
Denaturation95℃00:3030
Annealing58℃00:30
Extension72℃01:00
Final Extension72℃05:001

4℃**

The sufficient initial denaturation time of about 5 minutes ensure for complete denaturation of target DNA. If the denaturation is not sufficient, annealing and extension processes might be interrupted, and exact PCR outcome could not be obtained. It is also recommended having sufficient initial extension time for about 5 minutes with the same reason.

** At this temperature, PCR outcome can be most stably maintained without denaturation for storage. 

 

3) Confirmation of PCR outcome with Gel electrophoresis

3-1) Preparation of agarose gel

① Put 0.5X TBE buffer and agarose powder in Erlenmeyer flask and mix them well.

Size range of DNA samplesConcentration of agarose (w/v)TAE bufferAgarose
1kb ~ 30kb0.5%20mL0.10g
800bp ~ 12kb0.7%20mL0.14g
500bp ~ 10kb1.0%20mL0.20g
400bp ~ 7kb1.2%20mL0.24g
200bp ~ 3kb1.5%20mL0.30g
50bp ~ 2kb2.0%20mL0.40g

[Concentration of agarose depending on DNS sizes]

② Put the Erlenmeyer flask in the microwave and operate it for about 1 to 2 minutes to completely dissolve powder.

③ Insert comb (for casting the loading points of samples and ladder) to the gel plate and pour dissolved agarose.

4. Results


4. Results

    M         1         2         3          4        M
 



Lane
M100bp DNA Ladder
1PCR outcome of Primer set 1 (202bp)
2PCR outcome of Primer set 2 (304bp)
3PCR outcome of Primer set 3 (501bp)
4Negative Control


▲ Example image of gel electrophoresis of the PCR outcome  (Taken by: DuxGeldoc - Biomedux Co., Ltd.)

5. Precautions


5. Precautions

  • Cleaning apparatus and table using disinfectant solution in order to remove contaminants.
  • One target primer should be put in one PCR tube for ensuring an accurate experiment.

6. References

6. References


#PCR #Conventional PCR #Lambda Phage #DNA #Nucleic Acid Amplification #Electrophoresis

 








0 0