[PCR]#6 Salmonella PCR

관리자
12 Aug 2021
Views 50

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

Salmonella is a representative food poisoning causative agent, and a pathogen that causes such as typhoid fever and paratyphoid. We can Learn about the molecular biological detection method of this disease real-time PCR with the *gene of Salmonella

*The main target gene used to detect Salmonella is a gene called invA, Primers and probes are designed within the nucleotide sequence of this gene

2. Materials and equipment


2. Materials and equipment 

Materials

Roche apta Taq DNA master mix, Salmonella Primer set (Forward, Reverse), Probe, Salmonella (invA) DNA, dH2O

  • sequence of Primer

invA_F: GAATCCTCAGTTTTTCAACGTTTC

invA_R: CGAATTGCCCGAACGTGGCGA


  • Probe

invA_P: CGTCTGGCATTATCGATCAG-FAM


Equipment

Real-Time PCR (ex.CFX96 Touch Real-Time PCR Detection System - Bio-Rad)

3. Procedure


3. Procedure 

① Prepare invA DNA by diluting 10 times.


Sample 1Sample 2Sample 3Sample 4Sample 5Sample 6
DNAinvA 2uL2uL of DNA Sol.
from Sample 1
2uL of DNA Sol.
from Sample 2
2uL of DNA Sol.
from Sample 3
2uL of DNA Sol.
from Sample 4
2uL of DNA Sol.
from Sample 5
dH2O18uL18uL18uL18uL18uL18uL
Total20uL20uL20uL20uL20uL20uL


② PCR sample reagent composition


Sample 1 ~ 6N.C.
Master Mix10uL10uL
Primer Set3uL3uL
invA DNA5uL-
dH2O2uL7uL
Total20uL20uL


③ Set up the device according to the PCR conditions.

StepsTemperatureTime(min)Cycles
Early denaturation
50℃
02:001
Denaturation
95℃10:001
Annealing
95℃00:1540
Extension
60℃01:00


④ After PCR is finished, check the graph.

4. Results


4. Results

5. Precautions


5. Precautions 

① Be careful not to overexpose the light because it uses a fluorescent probe.

② When diluting DNA, be careful to transfer the correct amount with a pipette and dilute it.

③ After adding each composition of the sample, be careful not to create bubbles. Bubbles can interfere with the detection of the fluorescent signal.


#Salmonella #invA #CFX96





1 0