관리자
2 Sep 2021
Views 47

Contents

1.Introduction

2.Materials and equipment

3. Procedure

4. Results

5. Precautions

1. Introduction


1. Introduction

HPV is known as the human papilloma virus and is a DNA based virus that infects squamous epithelia of the skin and or mucous membranes of the human and other animals.

There are now more than 130 genotypes of the virus have been discovered. Including high risk HPV type 16 and HPV type 18 infection are linked to 70 percent of the worldwide cervical cancer cases.

The genomic DNAs HPV-16 and HPV-18 are confirmed the results through the electrophoresis after amplified by conventional PCR.

2. Materials and equipment


2. Materials and equipment 

Materials

*Taq polymerase (1unit/uL), 10X Taq buffer, **dNTP mix (25mM), HPV Primer set (Forward, Reverse), HPV16, 18 DNA, dH2O,

DNA ladder

*Taq polymerase: It is a microbial-derived polymerase called from Thermus aquaticus which is heat-stabe and synthesizes DNA .

**dNTP: A component of nucleic acid that acts as a substrate when polymerizing appeal synthesizes DNA. dNTP not only serves as a component of PCR reactions, but also provides the energy to synthesize nucleic acids.


  • Sequence of Primer

HPV_F: TTTGTTACTGTGGTAGATACCAC

HPV_R: GAAAAATAAACTGTAAATCATATTC


Equipment

Conventional PCR (ex.DuxCycler-Biomedux Co., Ltd, South Korea )

DNA Electrophoresis (ex.DuxGeldoc-Biomedux Co., Ltd, South Korea)

3. Procedure


3. Procedure 

① Provide HPV-16, & HPV-18 DNA by diluting 10 times


Sample 1Sample 2 Sample 3Sample 4Sample 5Sample 6Sample 7
DNA2uL DNA2uL DNA Sol.
from Sample 1
2uL DNA Sol.
from Sample 2
2uL DNA Sol.
from Sample 3
2uL DNA Sol.
from Sample 4
2uL DNA Sol.
from Sample 5
2uL DNA Sol.
from Sample 6
dH2O18uL18uL18uL18uL18uL18uL18uL
Total20uL20uL20uL20uL20uL20uL20uL


② PCR sample reagent composition


Sample 1 ~ 7N.C.
Taq polymerase0.5uL0.5uL
10X Taq buffer2uL2uL
dNTP0.08uL0.08uL
HPV_F (10pmole)0.1uL0.1uL
HPV_R (10pmole)1uL1uL
HPV16, 18 DNA4.5uL-
dH2O11.82uL16.32uL
Total20uL20uL


③ Set up the device according to the PCR conditions.

StepsTemperatureTime (min.)Cycles
Early denaturation95℃12:001
Denaturation94℃00:30
40
Annealing50℃01:00
Extension72℃00:30
Final extension72℃05:001

4. Results


4. Results

5. Precautions


5. Precautions 

1) During the experiment, pay attention to piecing so that DNA or PCR reagents do not become contaminated.

2) the temperature or reagent amount shall be carefully tested during the laboratory or test.


#HPV #Taq polymerase #dNTP




1 0