[PCR]#13 SARS CoV-2 : N gene single RT-LAMP

관리자
25 Oct 2021
Views 43

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

6. References 

1. Introduction


1. Introduction

Single RT-LAMP is performed to confirm whether N gene of SARS CoV-2 is appropriate as a target gene.

2. Materials and equipment


2. Materials and equipment 

Equipment

QuantStudio5(ABI device)

Sequence of Primer and Probe

TargetNameSequence (5' → 3')Length
SARS CoV-2 (N gene)N F3TGGACCCCAAAATCAGCG18
N B3GCCTTGTCCTCGAGGGAAT19
N FIPCCACTGCGTTCTCCATTCTGGTAAATGCACCCCGCATTACG41
N BIPCGCGATCAAAACAACGTCGGCCCTTGCCATGTTGAGTGAGA41
N BLPGGTTTACCCAATAATACTGCGTCTT25
N FLPTGAATCTGAGGGTCCACCAAA21
N BLP Probe 2[Cy5]- GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGGGGTTTACCCAATAATACTGCGTCTT60
Quencher probe 2CCTACCCTCGTCCTAACACGGGAGCCTGCACTGAC-[BHQ2]35

3. Procedure


3. Procedure 

① manufacture of the N gene Primer Mix 100µℓ

Reagent addedVolume
F34 uL
B34 uL
FIP3.3 uL
BIP3.3 uL
LF10 uL
LB4 uL
LB probe6 uL
DW65.4 uL
Total Volume100 uL


② N gene RT-LAMP reagent composition

ReagentVolume
2X Reaction buffer12.5 uL
Enzyme mix2.0 uL
Primer mix1.2 uL
Quencher2 solution0.06 uL
RNA Template2.5 uL
DW6.74 uL
Total Volume25 uL


③ Dilute the template stock solution of 10 6  [copy/uL] up to 10 0 [copy/uL] by ten times each.

④ For three positive controls and one negative control (4 in total), pre-mixing is prepared as a reagent except for RNA template and then mix and spin down is performed after including one extra reagent (22.5uL x 5=112.5uL).

⑤ Put 22.5uL of pre-mixture into 4 tubes.

⑥ After adding 2.5uL COVID-19 RNA template to only three tubes, add 2.5uL of DW to one tube to complete the reagent.

⑦ Put reagent in Quant Studio (ABI device), select Cy5 dye as a reporter with a condition of 60°C and 40 minutes for RT-LAMP, and start amplification and quantitative analysis (CT value).

4. Results


4. Results

Template concetration [copy/uL] CT value
10^620.14
10^620.46
10^6
20.52
0 (Negative Control)Undetermined


5. Precautions


5. Precautions 

1) Pay attention to pipetting so that RNA or PCR reagents are not contaminated during the experiment.

2) Be careful not to make a mistake in the temperature or the reagent amount s during the experiment is performed.

6. References

6. References 

Jang, Woong Sik et al. “Development of a multiplex Loop-Mediated Isothermal amplification (LAMP) assay for on-site diagnosis of SARS CoV-2.” PloS one vol. 16,3 e0248042. 3 Mar. 2021, doi:10.1371/journal.pone.0248042





2 0