[PCR]#4 Amplification test for Neisseria gonorrhoeae

관리자
30 Jul 2021
Views 54

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

*Neisseria gonorrhoeae is a bacteria that cause gonorrhea, one of the most common cause of sexually transmitted diseases of adults such as Chlamydia trachomatis, introduced firstly(from cervical urethral, and urine samples which loss of viability of Neisseria gonorrhoeae in particular is not an issue.)

Let’s proceed with real time PCR targeting for Neisseria gonorrhoeae. 

*What is characteristics Neisseria gonorrhoeae? Neisseria gonorrhoeae is aerobic, gram-negative diplococci are often arranged in pairs with flattened adjacent surfaces, giving the appearance of kidney or coffee beans. Usually infected through sexual intercourse, clinical manifestations is stings or rashes when peeing, and is often asymptomatic in women, while men have a few symptoms.

2. Materials and equipment


2. Materials and equipment 

Materials

TaqMan Gene expression master mix, Primer set (Forward, Reverse), Probe, Neisseria gonorrhoeae DNA, dH2O


  • Primer sequence

F: CCTTTGGTCTTGGTTTCCAACA

R: TCATAGCGATATGGAGCGTCAA

 

  • About Probe

P: CTCTGCTTCGGCTCT

 

equipment

Real time PCR (ex.QuantStudio5 - ABI, Thermo Fisher Scientific, USA)

3. Procedure


3. Procedure 

① Prepare ten-fold serial dilution of Neisseria gonorrhoeae DNA


Sample 1Sample 2Sample 3Sample 4Sample 5
DNA2uL2uL of DNA  solution from Sample 12uL of DNA  solution from Sample 22uL of DNA  solution from Sample 32uL of DNA  solution from Sample 4
dH2O18uL18uL18uL18uL18uL
Total20uL20uL20uL20uL20uL


② Composition of PCR sample reagent


Sample 1 ~ 5NC
Master Mix10uL10uL
Primer Set5uL5uL
NG DNA3uL-
dH2O2uL5uL
Total20uL20uL


③ Set up the device according to the PCR conditions 

StepsTemperatureTime (min)Cycles
Early Denaturation50℃02:001
Denaturation95℃10:001
Annealing95℃00:1540
Extension60℃01:00


④ Check the graph after PCR

4. Results


4. Results

5. Precautions


5. Precautions 

① Be careful avoid exposure to the light, because it may interfere with fluorescence of the probe

② Transfer the correct amount of DNA with pipetting during sample dilution step

③ Add all the ingredients of the sample and be careful not to foam.








1 0