[PCR]#5 CTNG Multiplex PCR

관리자
5 Aug 2021
Views 70

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

With DNA from Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (NG) conducted in the previous experiment, two DNA amplified simultaneously in one experiment through a *Multiplex PCR test.


*What is Multiplex PCR? Multiplex means the technique for detecting 2-4 targets in a single sample. In the case of real-time PCR, fluorescent substances are applied to the probe differently, and in the case of conventional PCR, the amplification product is applied differently.

Use of Multiplex PCR: Multiplex PCR is useful when there are a large number of detectable genes in the same sample, and a single test cab determines multiple pathogens and genotypes, saving time and money. It is used to determine STD diagnostic kits, HPV infections, and genotypes that can detect Multiple sexually transmitted microorganisms with a single examination, and whether tuberculosis is infected and or drug resistance. It is also used in forensic science and paternity test using STR markers, etc. 

2. Materials and equipment


2. Materials and equipment 

Materials

TaqMan Gene expression master mix, CT&NG Primer set (Forward, Reverse), Probe, CT DNA, NG DNA, dH2O

  • Primer sequence

CT_F: GCGGGCGATTTGCCTTA

CT_R: CGGTCAACGAAGAGGTTTTGTC

NG_F: CCTTTGGTCTTGGTTTCCAACA 

NG_R: TCATAGCGATATGGAGCGTCAA


  • Probes

CT_P: CGGAGCGAGTTACG-*FAM

NG_P: CTCTGCTTCGGCTCT-*HEX


*Real-time PCR is method of measuring fluorescence values of various wavelengths in real time and presenting results. Multiplex PCR is based on the range of wavelengths and fluorescence is determined by the type and attached to the probe of each target.

Wavelengths example:

FilterAbsorption wavelengthEmission wavelengthFluorescence

1490nm520nmFAM, SYBR Green Ⅰ
2520nm550nm
3550nm580nm
4580nm610nm
5630nm680nm


Equipment

Real time PCR Machine (QuantStudio5, ABI, Thermo Fisher Scientific, USA)

3. Procedure


3. Procedure 

① Prepare CT & NG DNA 10 times diluted.


Sample 1Sample 2Sample 3Sample 4Sample 5
DNA CT/NG2uL2uL of DNA Sol.
from Sample 1
2uL of DNA Sol.
from Sample 2
2uL of DNA Sol.
from Sample 3
2uL of DNA Sol.
from Sample 4
dH2O
16uL18uL18uL18uL18uL
Total20uL20uL
20uL
20uL
20uL


② Composition of PCR sample reagents.


Sample 1~5NC
Master Mix10uL10uL
Primer Set5uL5uL
CT & NG DNA3uL-
dH2O
2uL5uL
Total20uL20uL


③ Set up the device according to the PCR conditions.

StepsTemperatureTime (min)Cycles
Early denaturation
50℃
02:001
Denaturation
95℃10:001
Annealing
95℃00:1540
Extension
60℃01:00


④ Check the graph after PCR.

4. Results


4. Results

5. Precautions


5. Precautions 

① Because there are multiple targets and use corresponding fluorescence, this test (or We) should design probes so that they do not affect each other ‘s fluorescence wavelengths.

② Real time PCR instruments should select the right fluorescence for each target to enable fluorescence during experiment to avoid mistakes.


#Multiplex PCR #FAM #HEX




1 0