관리자
27 Aug 2021
Views 49

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

Vibrio is the leading cause of food poisoning, and it is also a pathogen that causes diseases such as typhoid and paratyphoid.  

With this Vibrio gene, we can find out how to detect the molecular biology of this diseases through real time PCR.

*The main target gene used to detect Vibrio is a gene called ToxR, which designs primers and probes within its sequence.

2. Materials and equipment


2. Materials and equipment 

Materials

Roche apta Taq DNA master mix, Vibrio Primer set (Forward, Reverse), Probe, Vibrio (ToxR) DNA, dH2O


  • Sequence of Primer

ToxR_F: TGCTTCTGATAACAATGACGCCT

ToxR_R: ACTGGCGCTTCTGGTTCAAC


  • Probe

ToxR_P: AGCGACGCCTTCTGACGCAA-FAM


Equipment

Real time PCR (ex.QuantStudio 5 Real-Time PCR System-ThermoFisher)

3. Procedure


3. Procedure 

① Prepare ToxR DNA by diluting 10 times.


Sample 1Sample 2Sample 3Sample 4Sample 5
Sample 6
DNAToxR 2uL2ul DNA Sol.
from Sample 1
2ul DNA Sol.
from Sample 2
2ul DNA Sol.
from Sample 3
2ul DNA Sol.
from Sample 4
2ul DNA Sol.
from Sample 5
dH2O18uL18uL
18uL
18uL
18uL
18uL
Total20uL20uL
20uL
20uL
20uL
20uL


② PCR sample reagent composition


Sample 1~6N.C.
Master Mix6uL6uL
Primer Set6uL
6uL
ToxR DNA3uL-
dH2O5uL8uL
Total20uL20uL


③ Set up the device according to the PCR conditions

StepsTemperatureTime (min.)Cycles
Denaturation50℃02:001
Annealing95℃00:3040
Extension60℃01:00


④ After PCR is finished, check the graph.

4. Results


4. Results

5. Precautions


5. Precautions 

① Use fluorescent probe, so be careful not to expose too much light.

② When diluting DNA, be careful to transfer the exact amount to the pipette and dilute it.

③After adding all the compositions of the sample, be careful not to create bubbles. Bubble can interfere with fluorescence detection


#Vibrio #ToxR #Quantstudio5







1 0