1. Introduction
1. Introduction
- Perform DNA isolation from K562 cell line, and conduct DNA amplification and detection using PCR from the isolated DNA.
- Through this experiment, DNA isolation techniques and the applications of each extraction reagent can be learned
2. Materials and equipment
2. Materials and equipment
Materials
1) DNA extraction reagent
| Reagent | Role |
|---|
| AVL buffer | As a cell lysis buffer (Qiagen, Germany), it enables cell lysis (decomposition and dissolution). |
| Proteinase K | Degrades unnecessary residual proteins from the lysed cell |
| 100% Ethanol | DNA condensation, precipitation to facilitate beads binding. |
| MagAttract Suspension G (Beads) | As a magnetic bead solution, (Qiagen, Germany) it allows the lysed DNA from the cell to be collected and attached to a surface. |
| AW1 buffer, AW2 buffer | As a washing buffer, (Qiagen, Germany) it allows unnecessary particle to be washed away from the DNA attached to the beads. |
| AE buffer | As an elution buffer, (Qiagen, Germany) it washes away the DNA from the beads at the final step of the experiment. |
2) PCR reagent
DNA Polymerase 2X Master mix, Primer set、K562 DNA, dH2O, DNA Ladder(100bp)
- Sequence information of the primer used in this experiment (refer to the article)
F: TCAGTATGTGACTTGGATTG
R: GATAAATACATAGGATGGATGG
Equipment
Conventional PCR (ex.DuxCycler- Biomedux, South Korea)
DNA Electrophoresis (ex.DuxGeldoc- Biomedux, South Korea)
3. Procedure
3. Procedure
1) DNA extraction (refer to QIAamp DNA kit)
① Add 20uL of Proteinase K to 200uL of Sample
② Add 25uL of MagAttract Suspension G(beads) to 200uL of 100% Ethanol preparing according to the number of samples
③ Add 200uL of AVL buffer into tube ① and vortex it for 15-30 seconds
④ Add tube ②’s reagents (100% ethanol + beads) into tube ③ and vortex it for 15-30 seconds
⑤ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.
⑥ Add 500mL of AW1 buffer and vortex it for 15-30 seconds.
⑦ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.
⑧ Add 500mL of AW2 buffer and vortex it for 15-30 seconds.
⑨ Collect beads in the sample for 1-2 minutes using a magnet and throw the solution.
⑩ Dry for 1-2 minutes with the cap of sample open.
⑪ Add 500mL of AE buffer, vortex it for 15-30 seconds, and wait for 1 minute at room temperature.
⑫ Attract beads in the sample for 1-2 minutes using a magnet and collect the *solution.
2) PCR sample reagent composition
| Sample | NC |
|---|
| 2X Master Mix | 10 uL | 10 uL |
| Primer Set | 1 uL | 1 uL |
| K562 DNA | 6 uL | - |
| dH2O | 3 uL | 9 uL |
| Total | 20 uL | 20 uL |
3) Set up the device according to the PCR conditions
| Stage | Temperature | Time | Cycles |
|---|
| Pre-denaturation | 95℃ | 05:00 | 1 |
| Denaturation | 95℃ | 00:30 | 35* |
| Annealing | 55℃* | 00:30 |
| Extension | 72℃ | 01:00 |
| Final Extension | 72℃ | 05:00 | 1 |
| 4℃ | ∞ |
|
* There is a Master mix to use for each experiment. Each Master mix has a recommended temperature, time, and the number of cycles. You will experiment within these ranges. The conditions are determined according to the influencing factors, such as the size of the DNA for the experiment or the length of the primer.
4) After PCR is completed, check the amplified PCR product by using agarose gel electrophoresis
4. Results
4. Results
(▲Image: DuxGeldoc - Biomedux, South Korea)
| Lane |
|
|---|
| M | 100bp DNA Ladder |
| 1 | K562 DNA (116bp) |
| 2 | Negative Control |
5. Precautions
5. Precautions
1) Be careful not to contaminate DNA or PCR reagents during the experiment.
2) Be careful not to make a mistake in the PCR temperature or amount of reagents during the experiment.
6. References
6. References (Attached)
#K562 DNA #DNA Extraction #Conventianal PCR
Contents
1.Introduction
2.Materials and equipment
3.Procedure
4.Results
5.Precautions
6.References
1. Introduction
1. Introduction
- Perform DNA isolation from K562 cell line, and conduct DNA amplification and detection using PCR from the isolated DNA.
- Through this experiment, DNA isolation techniques and the applications of each extraction reagent can be learned
2. Materials and equipment
2. Materials and equipment
Materials
1) DNA extraction reagent
2) PCR reagent
DNA Polymerase 2X Master mix, Primer set、K562 DNA, dH2O, DNA Ladder(100bp)
F: TCAGTATGTGACTTGGATTG
R: GATAAATACATAGGATGGATGG
Equipment
Conventional PCR (ex.DuxCycler- Biomedux, South Korea)
DNA Electrophoresis (ex.DuxGeldoc- Biomedux, South Korea)
3. Procedure
3. Procedure
1) DNA extraction (refer to QIAamp DNA kit)
① Add 20uL of Proteinase K to 200uL of Sample
② Add 25uL of MagAttract Suspension G(beads) to 200uL of 100% Ethanol preparing according to the number of samples
③ Add 200uL of AVL buffer into tube ① and vortex it for 15-30 seconds
④ Add tube ②’s reagents (100% ethanol + beads) into tube ③ and vortex it for 15-30 seconds
⑤ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.
⑥ Add 500mL of AW1 buffer and vortex it for 15-30 seconds.
⑦ Collect beads in the sample for 1-2 minutes using a magnet and discard the solution.
⑧ Add 500mL of AW2 buffer and vortex it for 15-30 seconds.
⑨ Collect beads in the sample for 1-2 minutes using a magnet and throw the solution.
⑩ Dry for 1-2 minutes with the cap of sample open.
⑪ Add 500mL of AE buffer, vortex it for 15-30 seconds, and wait for 1 minute at room temperature.
⑫ Attract beads in the sample for 1-2 minutes using a magnet and collect the *solution.
2) PCR sample reagent composition
3) Set up the device according to the PCR conditions
* There is a Master mix to use for each experiment. Each Master mix has a recommended temperature, time, and the number of cycles. You will experiment within these ranges. The conditions are determined according to the influencing factors, such as the size of the DNA for the experiment or the length of the primer.
4) After PCR is completed, check the amplified PCR product by using agarose gel electrophoresis
4. Results
4. Results
5. Precautions
5. Precautions
1) Be careful not to contaminate DNA or PCR reagents during the experiment.
2) Be careful not to make a mistake in the PCR temperature or amount of reagents during the experiment.
6. References
6. References (Attached)
#K562 DNA #DNA Extraction #Conventianal PCR