1. Introduction
1. Introduction
To understand the mechanism of *real-time PCR by using the DNA of **Chlamydia trachomatis, one of the bacteria that cause sexually transmitted diseases.
* What is real-time PCR? It is also known as quantitative PCR, for its ability to accurately quantify PCR products that are being amplified by real-time monitoring. The amount of DNA increases at a rate of 2ⁿ for every PCR cycle, where n denotes the number of cycles, where the amount is drawn on a graph simultaneously. Because conventional PCR ensures the presence or absence of a band through electrophoretic methods, real-time PCR may be a choice for higher sensitivity and resolution.
** What is Chlamydia trachomatis? Chlamydia trachomatis, commonly known as chlamydia, is a sexually transmitted bacterium that can cause various infections, which can be manifested as trachoma, lymphogranuloma venereum, non-gonococcal urethritis, cervicitis, salpingitis, and pelvic inflammatory diseases.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, Primer set (Forward, Reverse, *Probe), Chlamydia trachomatis DNA, dH2O
*What is a probe? In real-time PCR, a primer with fluorescent molecule attached is added to the pair of primer set. The fluorescent molecule does not emit light during the annealing step, but in the extension phase the molecule gets detached from the primer by DNA polymerase, emitting fluorescent light. The amount of DNA can be quantified in real-time by measuring intensity of light emission.
F: GCGGGCGATTTGCCTTA
R: CGGTCAACGAAGAGGTTTTGTC
P: CGGAGCGAGTTACG
Equipment
Real time PCR (ex.QuantStudio5- Thermofisher)
3. Procedure
3. Procedure
① Prepare ten-fold serial dilutions of Chlamydia trachomatis DNA.
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 |
|---|
| DNA | 2uL | 2uL of DNA solution from Sample 1 | 2uL of DNA solution from Sample 2 | 2uL of DNA solution from Sample 3 | 2uL of DNA solution from Sample 4 |
| dH2O | 18uL | 18uL | 18uL | 18uL | 18uL |
| Total | 20uL | 20uL | 20uL | 20uL | 20uL |
② Composition of PCR Sample Reagent
| Sample 1 ~ 5 | NC |
|---|
| Master Mix | 10uL | 10uL |
| Primer Set | 5uL | 5uL |
| CT DNA | 3uL | - |
| dH2O | 2uL | 5uL |
| Total | 20uL | 20uL |
③ Choose the setting appropriate for PCR.
| Steps | Temperature | Time | Cycles |
|---|
Early Denaturation
| 50℃
| 02:00
| 1
|
Denaturation
| 95℃
| 10:00
| 1 |
Annealing
| 95℃
| 00:15 | 40 |
Extension
| 60℃
| 01:00 |
*Final extension and stabilization at 4℃ are unnecessary because graphical results are obtained real-time.
4. Results
4. Results
The amount of DNA expressed can be confirmed by looking at the graph for each sample and obtaining the Ct value. Ct value, or cycle threshold, is the number of cycles at which the fluorescent signal crosses the threshold. It is recognizable from the graph that the Ct value of each sample gets pushed further as it gets more diluted. By making interpretations from such results, it can be used for other purposes, such as analyzing gene expression, detecting virus or other pathogens.
5. Precautions
5. Precautions
① Avoid exposure to light, because it may interfere with the fluorescence of the probe.
② Transfer the correct amount of DNA with the pipette during sample dilution.
#Chlamydia trachomatis #Real Time PCR #Quantitative PCR
Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
To understand the mechanism of *real-time PCR by using the DNA of **Chlamydia trachomatis, one of the bacteria that cause sexually transmitted diseases.
* What is real-time PCR? It is also known as quantitative PCR, for its ability to accurately quantify PCR products that are being amplified by real-time monitoring. The amount of DNA increases at a rate of 2ⁿ for every PCR cycle, where n denotes the number of cycles, where the amount is drawn on a graph simultaneously. Because conventional PCR ensures the presence or absence of a band through electrophoretic methods, real-time PCR may be a choice for higher sensitivity and resolution.
** What is Chlamydia trachomatis? Chlamydia trachomatis, commonly known as chlamydia, is a sexually transmitted bacterium that can cause various infections, which can be manifested as trachoma, lymphogranuloma venereum, non-gonococcal urethritis, cervicitis, salpingitis, and pelvic inflammatory diseases.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, Primer set (Forward, Reverse, *Probe), Chlamydia trachomatis DNA, dH2O
*What is a probe? In real-time PCR, a primer with fluorescent molecule attached is added to the pair of primer set. The fluorescent molecule does not emit light during the annealing step, but in the extension phase the molecule gets detached from the primer by DNA polymerase, emitting fluorescent light. The amount of DNA can be quantified in real-time by measuring intensity of light emission.
F: GCGGGCGATTTGCCTTA
R: CGGTCAACGAAGAGGTTTTGTC
P: CGGAGCGAGTTACG
Equipment
Real time PCR (ex.QuantStudio5- Thermofisher)
3. Procedure
3. Procedure
① Prepare ten-fold serial dilutions of Chlamydia trachomatis DNA.
② Composition of PCR Sample Reagent
③ Choose the setting appropriate for PCR.
*Final extension and stabilization at 4℃ are unnecessary because graphical results are obtained real-time.
4. Results
4. Results
The amount of DNA expressed can be confirmed by looking at the graph for each sample and obtaining the Ct value. Ct value, or cycle threshold, is the number of cycles at which the fluorescent signal crosses the threshold. It is recognizable from the graph that the Ct value of each sample gets pushed further as it gets more diluted. By making interpretations from such results, it can be used for other purposes, such as analyzing gene expression, detecting virus or other pathogens.
5. Precautions
5. Precautions
① Avoid exposure to light, because it may interfere with the fluorescence of the probe.
② Transfer the correct amount of DNA with the pipette during sample dilution.
#Chlamydia trachomatis #Real Time PCR #Quantitative PCR