1. Introduction
1. Introduction
*Neisseria gonorrhoeae is a bacteria that cause gonorrhea, one of the most common cause of sexually transmitted diseases of adults such as Chlamydia trachomatis, introduced firstly(from cervical urethral, and urine samples which loss of viability of Neisseria gonorrhoeae in particular is not an issue.)
Let’s proceed with real time PCR targeting for Neisseria gonorrhoeae.
*What is characteristics Neisseria gonorrhoeae? Neisseria gonorrhoeae is aerobic, gram-negative diplococci are often arranged in pairs with flattened adjacent surfaces, giving the appearance of kidney or coffee beans. Usually infected through sexual intercourse, clinical manifestations is stings or rashes when peeing, and is often asymptomatic in women, while men have a few symptoms.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, Primer set (Forward, Reverse), Probe, Neisseria gonorrhoeae DNA, dH2O
F: CCTTTGGTCTTGGTTTCCAACA
R: TCATAGCGATATGGAGCGTCAA
P: CTCTGCTTCGGCTCT
equipment
Real time PCR (ex.QuantStudio5 - ABI, Thermo Fisher Scientific, USA)
3. Procedure
3. Procedure
① Prepare ten-fold serial dilution of Neisseria gonorrhoeae DNA
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 |
|---|
| DNA | 2uL | 2uL of DNA solution from Sample 1 | 2uL of DNA solution from Sample 2 | 2uL of DNA solution from Sample 3 | 2uL of DNA solution from Sample 4 |
| dH2O | 18uL | 18uL | 18uL | 18uL | 18uL |
| Total | 20uL | 20uL | 20uL | 20uL | 20uL |
② Composition of PCR sample reagent
| Sample 1 ~ 5 | NC |
|---|
| Master Mix | 10uL | 10uL |
| Primer Set | 5uL | 5uL |
| NG DNA | 3uL | - |
| dH2O | 2uL | 5uL |
| Total | 20uL | 20uL |
③ Set up the device according to the PCR conditions
| Steps | Temperature | Time (min) | Cycles |
|---|
| Early Denaturation | 50℃ | 02:00 | 1 |
| Denaturation | 95℃ | 10:00 | 1 |
| Annealing | 95℃ | 00:15 | 40 |
| Extension | 60℃ | 01:00 |
④ Check the graph after PCR
4. Results
4. Results
5. Precautions
5. Precautions
① Be careful avoid exposure to the light, because it may interfere with fluorescence of the probe
② Transfer the correct amount of DNA with pipetting during sample dilution step
③ Add all the ingredients of the sample and be careful not to foam.
Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
*Neisseria gonorrhoeae is a bacteria that cause gonorrhea, one of the most common cause of sexually transmitted diseases of adults such as Chlamydia trachomatis, introduced firstly(from cervical urethral, and urine samples which loss of viability of Neisseria gonorrhoeae in particular is not an issue.)
Let’s proceed with real time PCR targeting for Neisseria gonorrhoeae.
*What is characteristics Neisseria gonorrhoeae? Neisseria gonorrhoeae is aerobic, gram-negative diplococci are often arranged in pairs with flattened adjacent surfaces, giving the appearance of kidney or coffee beans. Usually infected through sexual intercourse, clinical manifestations is stings or rashes when peeing, and is often asymptomatic in women, while men have a few symptoms.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, Primer set (Forward, Reverse), Probe, Neisseria gonorrhoeae DNA, dH2O
F: CCTTTGGTCTTGGTTTCCAACA
R: TCATAGCGATATGGAGCGTCAA
P: CTCTGCTTCGGCTCT
equipment
Real time PCR (ex.QuantStudio5 - ABI, Thermo Fisher Scientific, USA)
3. Procedure
3. Procedure
① Prepare ten-fold serial dilution of Neisseria gonorrhoeae DNA
② Composition of PCR sample reagent
③ Set up the device according to the PCR conditions
④ Check the graph after PCR
4. Results
4. Results
5. Precautions
5. Precautions
① Be careful avoid exposure to the light, because it may interfere with fluorescence of the probe
② Transfer the correct amount of DNA with pipetting during sample dilution step
③ Add all the ingredients of the sample and be careful not to foam.