1. Introduction
1. Introduction
Salmonella is a representative food poisoning causative agent, and a pathogen that causes such as typhoid fever and paratyphoid. We can Learn about the molecular biological detection method of this disease real-time PCR with the *gene of Salmonella.
*The main target gene used to detect Salmonella is a gene called invA, Primers and probes are designed within the nucleotide sequence of this gene
2. Materials and equipment
2. Materials and equipment
Materials
Roche apta Taq DNA master mix, Salmonella Primer set (Forward, Reverse), Probe, Salmonella (invA) DNA, dH2O
invA_F: GAATCCTCAGTTTTTCAACGTTTC
invA_R: CGAATTGCCCGAACGTGGCGA
invA_P: CGTCTGGCATTATCGATCAG-FAM
Equipment
Real-Time PCR (ex.CFX96 Touch Real-Time PCR Detection System - Bio-Rad)
3. Procedure
3. Procedure
① Prepare invA DNA by diluting 10 times.
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 | Sample 6 |
---|
DNA | invA 2uL | 2uL of DNA Sol. from Sample 1 | 2uL of DNA Sol. from Sample 2 | 2uL of DNA Sol. from Sample 3 | 2uL of DNA Sol. from Sample 4 | 2uL of DNA Sol. from Sample 5 |
dH2O | 18uL | 18uL | 18uL | 18uL | 18uL | 18uL |
Total | 20uL | 20uL | 20uL | 20uL | 20uL | 20uL |
② PCR sample reagent composition
| Sample 1 ~ 6 | N.C. |
---|
Master Mix | 10uL | 10uL |
Primer Set | 3uL | 3uL |
invA DNA | 5uL | - |
dH2O | 2uL | 7uL |
Total | 20uL | 20uL |
③ Set up the device according to the PCR conditions.
Steps | Temperature | Time(min) | Cycles |
---|
Early denaturation
| 50℃
| 02:00 | 1 |
Denaturation
| 95℃ | 10:00 | 1 |
Annealing
| 95℃ | 00:15 | 40 |
Extension
| 60℃ | 01:00 |
④ After PCR is finished, check the graph.
4. Results
4. Results

5. Precautions
5. Precautions
① Be careful not to overexpose the light because it uses a fluorescent probe.
② When diluting DNA, be careful to transfer the correct amount with a pipette and dilute it.
③ After adding each composition of the sample, be careful not to create bubbles. Bubbles can interfere with the detection of the fluorescent signal.
#Salmonella #invA #CFX96

Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
Salmonella is a representative food poisoning causative agent, and a pathogen that causes such as typhoid fever and paratyphoid. We can Learn about the molecular biological detection method of this disease real-time PCR with the *gene of Salmonella.
*The main target gene used to detect Salmonella is a gene called invA, Primers and probes are designed within the nucleotide sequence of this gene
2. Materials and equipment
2. Materials and equipment
Materials
Roche apta Taq DNA master mix, Salmonella Primer set (Forward, Reverse), Probe, Salmonella (invA) DNA, dH2O
invA_F: GAATCCTCAGTTTTTCAACGTTTC
invA_R: CGAATTGCCCGAACGTGGCGA
invA_P: CGTCTGGCATTATCGATCAG-FAM
Equipment
Real-Time PCR (ex.CFX96 Touch Real-Time PCR Detection System - Bio-Rad)
3. Procedure
3. Procedure
① Prepare invA DNA by diluting 10 times.
from Sample 1
from Sample 2
from Sample 3
from Sample 4
from Sample 5
② PCR sample reagent composition
③ Set up the device according to the PCR conditions.
④ After PCR is finished, check the graph.
4. Results
4. Results
5. Precautions
5. Precautions
① Be careful not to overexpose the light because it uses a fluorescent probe.
② When diluting DNA, be careful to transfer the correct amount with a pipette and dilute it.
③ After adding each composition of the sample, be careful not to create bubbles. Bubbles can interfere with the detection of the fluorescent signal.
#Salmonella #invA #CFX96