1. Introduction
1. Introduction
Vibrio is the leading cause of food poisoning, and it is also a pathogen that causes diseases such as typhoid and paratyphoid.
With this Vibrio gene* , we can find out how to detect the molecular biology of this diseases through real time PCR.
*The main target gene used to detect Vibrio is a gene called ToxR, which designs primers and probes within its sequence.
2. Materials and equipment
2. Materials and equipment
Materials
Roche apta Taq DNA master mix, Vibrio Primer set (Forward, Reverse), Probe, Vibrio (ToxR) DNA, dH2O
ToxR_F: TGCTTCTGATAACAATGACGCCT
ToxR_R: ACTGGCGCTTCTGGTTCAAC
ToxR_P: AGCGACGCCTTCTGACGCAA-FAM
Equipment
Real time PCR (ex.QuantStudio 5 Real-Time PCR System-ThermoFisher)
3. Procedure
3. Procedure
① Prepare ToxR DNA by diluting 10 times.
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 | Sample 6 |
|---|
| DNA | ToxR 2uL | 2ul DNA Sol.
from Sample 1
| 2ul DNA Sol.
from Sample 2
| 2ul DNA Sol.
from Sample 3
| 2ul DNA Sol.
from Sample 4
| 2ul DNA Sol.
from Sample 5
|
| dH2O | 18uL | 18uL
| 18uL
| 18uL
| 18uL
| 18uL
|
| Total | 20uL | 20uL
| 20uL
| 20uL
| 20uL
| 20uL
|
② PCR sample reagent composition
| Sample 1~6 | N.C. |
|---|
| Master Mix | 6uL | 6uL |
| Primer Set | 6uL
| 6uL |
| ToxR DNA | 3uL | - |
| dH2O | 5uL | 8uL |
| Total | 20uL | 20uL |
③ Set up the device according to the PCR conditions
| Steps | Temperature | Time (min.) | Cycles |
|---|
| Denaturation | 50℃ | 02:00 | 1 |
| Annealing | 95℃ | 00:30 | 40 |
| Extension | 60℃ | 01:00 |
④ After PCR is finished, check the graph.
4. Results
4. Results
5. Precautions
5. Precautions
① Use fluorescent probe, so be careful not to expose too much light.
② When diluting DNA, be careful to transfer the exact amount to the pipette and dilute it.
③After adding all the compositions of the sample, be careful not to create bubbles. Bubble can interfere with fluorescence detection
#Vibrio #ToxR #Quantstudio5
Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
Vibrio is the leading cause of food poisoning, and it is also a pathogen that causes diseases such as typhoid and paratyphoid.
With this Vibrio gene* , we can find out how to detect the molecular biology of this diseases through real time PCR.
*The main target gene used to detect Vibrio is a gene called ToxR, which designs primers and probes within its sequence.
2. Materials and equipment
2. Materials and equipment
Materials
Roche apta Taq DNA master mix, Vibrio Primer set (Forward, Reverse), Probe, Vibrio (ToxR) DNA, dH2O
ToxR_F: TGCTTCTGATAACAATGACGCCT
ToxR_R: ACTGGCGCTTCTGGTTCAAC
ToxR_P: AGCGACGCCTTCTGACGCAA-FAM
Equipment
Real time PCR (ex.QuantStudio 5 Real-Time PCR System-ThermoFisher)
3. Procedure
3. Procedure
① Prepare ToxR DNA by diluting 10 times.
from Sample 1
from Sample 2
from Sample 3
from Sample 4
from Sample 5
② PCR sample reagent composition
③ Set up the device according to the PCR conditions
④ After PCR is finished, check the graph.
4. Results
4. Results
5. Precautions
5. Precautions
① Use fluorescent probe, so be careful not to expose too much light.
② When diluting DNA, be careful to transfer the exact amount to the pipette and dilute it.
③After adding all the compositions of the sample, be careful not to create bubbles. Bubble can interfere with fluorescence detection
#Vibrio #ToxR #Quantstudio5