1. Introduction
1. Introduction
HPV is known as the human papilloma virus and is a DNA based virus that infects squamous epithelia of the skin and or mucous membranes of the human and other animals.
There are now more than 130 genotypes of the virus have been discovered. Including high risk HPV type 16 and HPV type 18 infection are linked to 70 percent of the worldwide cervical cancer cases.
The genomic DNAs HPV-16 and HPV-18 are confirmed the results through the electrophoresis after amplified by conventional PCR.
2. Materials and equipment
2. Materials and equipment
Materials
*Taq polymerase (1unit/uL), 10X Taq buffer, **dNTP mix (25mM), HPV Primer set (Forward, Reverse), HPV16, 18 DNA, dH2O,
DNA ladder
*Taq polymerase: It is a microbial-derived polymerase called from Thermus aquaticus which is heat-stabe and synthesizes DNA .
**dNTP: A component of nucleic acid that acts as a substrate when polymerizing appeal synthesizes DNA. dNTP not only serves as a component of PCR reactions, but also provides the energy to synthesize nucleic acids.
HPV_F: TTTGTTACTGTGGTAGATACCAC
HPV_R: GAAAAATAAACTGTAAATCATATTC
Equipment
Conventional PCR (ex.DuxCycler-Biomedux Co., Ltd, South Korea )
DNA Electrophoresis (ex.DuxGeldoc-Biomedux Co., Ltd, South Korea)
3. Procedure
3. Procedure
① Provide HPV-16, & HPV-18 DNA by diluting 10 times
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 | Sample 6 | Sample 7 |
---|
DNA | 2uL DNA | 2uL DNA Sol. from Sample 1 | 2uL DNA Sol. from Sample 2 | 2uL DNA Sol. from Sample 3 | 2uL DNA Sol. from Sample 4 | 2uL DNA Sol. from Sample 5 | 2uL DNA Sol. from Sample 6 |
dH2O | 18uL | 18uL | 18uL | 18uL | 18uL | 18uL | 18uL |
Total | 20uL | 20uL | 20uL | 20uL | 20uL | 20uL | 20uL |
② PCR sample reagent composition
| Sample 1 ~ 7 | N.C. |
---|
Taq polymerase | 0.5uL | 0.5uL |
10X Taq buffer | 2uL | 2uL |
dNTP | 0.08uL | 0.08uL |
HPV_F (10pmole) | 0.1uL | 0.1uL |
HPV_R (10pmole) | 1uL | 1uL |
HPV16, 18 DNA | 4.5uL | - |
dH2O | 11.82uL | 16.32uL |
Total | 20uL | 20uL |
③ Set up the device according to the PCR conditions.
Steps | Temperature | Time (min.) | Cycles |
---|
Early denaturation | 95℃ | 12:00 | 1 |
Denaturation | 94℃ | 00:30 | 40 |
Annealing | 50℃ | 01:00 |
Extension | 72℃ | 00:30 |
Final extension | 72℃ | 05:00 | 1 |
4. Results
4. Results

5. Precautions
5. Precautions
1) During the experiment, pay attention to piecing so that DNA or PCR reagents do not become contaminated.
2) the temperature or reagent amount shall be carefully tested during the laboratory or test.
#HPV #Taq polymerase #dNTP

Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
HPV is known as the human papilloma virus and is a DNA based virus that infects squamous epithelia of the skin and or mucous membranes of the human and other animals.
There are now more than 130 genotypes of the virus have been discovered. Including high risk HPV type 16 and HPV type 18 infection are linked to 70 percent of the worldwide cervical cancer cases.
The genomic DNAs HPV-16 and HPV-18 are confirmed the results through the electrophoresis after amplified by conventional PCR.
2. Materials and equipment
2. Materials and equipment
Materials
*Taq polymerase (1unit/uL), 10X Taq buffer, **dNTP mix (25mM), HPV Primer set (Forward, Reverse), HPV16, 18 DNA, dH2O,
DNA ladder
*Taq polymerase: It is a microbial-derived polymerase called from Thermus aquaticus which is heat-stabe and synthesizes DNA .
**dNTP: A component of nucleic acid that acts as a substrate when polymerizing appeal synthesizes DNA. dNTP not only serves as a component of PCR reactions, but also provides the energy to synthesize nucleic acids.
HPV_F: TTTGTTACTGTGGTAGATACCAC
HPV_R: GAAAAATAAACTGTAAATCATATTC
Equipment
Conventional PCR (ex.DuxCycler-Biomedux Co., Ltd, South Korea )
DNA Electrophoresis (ex.DuxGeldoc-Biomedux Co., Ltd, South Korea)
3. Procedure
3. Procedure
① Provide HPV-16, & HPV-18 DNA by diluting 10 times
from Sample 1
from Sample 2
from Sample 3
from Sample 4
from Sample 5
from Sample 6
② PCR sample reagent composition
③ Set up the device according to the PCR conditions.
4. Results
4. Results
5. Precautions
5. Precautions
1) During the experiment, pay attention to piecing so that DNA or PCR reagents do not become contaminated.
2) the temperature or reagent amount shall be carefully tested during the laboratory or test.
#HPV #Taq polymerase #dNTP