[PCR]#20 Discovery of gene SNP related to Korean Beef economical traits

관리자
20 Dec 2021
Views 181

Contents

1.Introduction 

2.Materials and equipment 

3. Procedure 

4. Results 

5. Precautions 

1. Introduction


1. Introduction

- A study on characteristics of major genes that affect livestock economic traits, and the use of genetic variations in which traits are different between individuals by SNP.

- The development of DNA molecular markers related to economic traits with high industrial utilization value can increase the growth rate of Korean beef

- Gene CRH, DECR1, POMC, MC4R

2. Materials and equipment


2. Materials and equipment 

- Materials

- 24 hair roots of Korean beef, which are not family –friendly


- Sequence of Primer, Probe

Primers information

Table 1. PCR primers for amplification of DECR1 gene in this study

Marker

Forward primer(5`-3`)

Reverse primer(5`-3`)

DECR1_1

AGGGTCATCCCAGTACACCAG

GAGGTGGATGAAACTGGAACC

DECR1_2

GAAGTTATGGGACCGGATGC

TTCAGGGTTCCCCAAATACC

DECR1_3

ACAGGGATCAAGACCATCCC

TTTCTGTCCTTTATCGAGCCC

DECR1_4

TTGGAAAACTCAGCAGTGGC

TTCAAGAGGCAGGTCAGGTG

DECR1_5

AGCATTTATTACCGGGGGAG

TGCCCGTCTTATAGGAAATGG

DECR1_6

GCCAGCTCTTTTTGCTAGGG

AAGGCTTCTTTCCAATATGCG

DECR1_7

TTTGCTTTTGTTTGGTTCGC

CAAATTTTGGAATTCTAATCCG

DECR1_8

GGCACTTTAATTGAGATTCCTTG

ACAAAGGCTGTGCCATTCAG

DECR1_9

CTGGCCATGACTTTCCTTCC

CATGAGAAACACTGGGCTGG

DECR1_10

TGATTCCAGCTTGTGCTTCC

AGGGGGTGACAGAGGATGAG

DECR1_11

GGGACCCCTGTAATGCAAAT

GGGACAAGATCAAACCCCAG

DECR1_12

TCCTCATTCTCACCGAGCTT

TGTTGGAAGAGGGTGTTTGC

DECR1_13

GCAAAAACAAGACCTGGAGATG

AGCAGCAGCAGTAGGGTGTG

 

Table 2. PCR primers for amplification of MC4R gene in this study

Marker

Forward primer(5`-3`)

Reverse primer(5`-3`)

MC4R_1

TGAGAGCATGCGCACATAGA

AGTAGCCTTTTGCCAGGGAC

MC4R_2

GATGCTGACCAGAGCCACAC

TTGGAAACGCTCACCAACAT

MC4R_3

GCTCTTTGTCTCTCCCGAGG

GCCAGCATGGTGAAGAACAC

MC4R_4

GTCGGGCGTCTTGTTCATC

GCTTGTGTTTAGCATCGCGT

MC4R_5

TGCAATTCCATCATTGACCC

AGCAAGCAAAGTGTCACATCC

MC4R_6

TCCACATCACAGGTTATAGGCAC

TCCCAAATTGCCTGTGAGAA

MC4R_7

TTTCTCATTCATTCTTCCTGTGC

GTAAGTCACTTGCATGTGGAAAA

 

Table 3. PCR primers for amplification of NPY gene in this study

Marker

Forward primer(5`-3`)

Reverse primer(5`-3`)

NPY_1

TGTGCACAGTGCCAAGACTG

CCCAGAGCAGCATCAATGAC

NPY_2

TTAGATTGGGGAAGCATAGGG

GAAAGCCCCAAGTTTCCAAG


Table 4. PCR primers for amplification of CRH gene in this study

Marker

Forward primer(5`-3`)

Reverse primer(5`-3`)

CRH_1

AGAAGGGAAGAGAACCGCTG

GCTCGTTTACACAGCGAGGA

CRH_2

CGTGCCACAAGATTCCAATAG

TCCCCTGTCTAACGATTCCC

CRH_3

GAGCCCTTGAGACCACGAAT

GCGCTAATTGCGGTACAGAG

CRH_4

TTTTCTCTCTCATTCCGCCC

AGAAAGGCGACTGCTGCTTC

 

Table 5. PCR primers for amplification of POMC gene in this study

Marker

Forward primer(5`-3`)

Reverse primer(5`-3`)

POMC

CCTCGAATTCAAGAGGGAGC

AGAGAGGCCTTCAGGGTCAA

Sequence variations Hanwoo

Table 1. Sequence variations Hanwoo in DECR1 gene

SNP number and primer for detection

Location in DECR1 gene

Variations in Korean cattle

(Hanwoo) in this study

Sequence

Frequency

1 DECR1_1

Intron 1 (5634)

T/A

1.00/0.00

2 DECR1_1

Intron 1 (5636)

T/G

0.00/1.00

3 DECR1_1

Intron 1 (5624)

T/A

0.633/0.367

4 DECR1_1

Intron 1 (5658)

C/T

0.50/0.50

5 DECR1_3

Intron 1 (17651)

A/T

1.00/0.00

6 DECR1_3

Intron 1 (17652)

G/A

1.00/0.00

7 DECR1_4

Intron 1 (18318)

C/T

1.00/0.00

8 DECR1_4

Intron 1 (18240)

G/A

0.00/1.00

9 DECR1_4

Intron 1 (18243)

T/C

0.50/0.50

10 DECR1_4

Intron 1 (18251)

A/G

0.00/1.00

11 DECR1_4

Intron 1 (18261)

A/T

0.50/0.50

12 DECR1_5

Exon 2 (20788)

G/A

0.479/0.521

13 DECR1_5

Exon 2 (20796)

G/C

0.271/0.729

14 DECR1_5

Intron 2 (20830)

A/G

0.271/0.729

15 DECR1_5

Intron 2 (20986)

C/T

0.271/0.729

16 DECR1_5

Intron 2 (21053)

A/G

0.271/0.729

17 DECR1_5

Intron 2 (21093)

G/A

0.229/0.771

18 DECR1_7

Intron 4 (22982)

T/C

0.271/0.729

19 DECR1_8

Intron 4 (22991)

G/C

0.864/0.136

20 DECR1_8

Intron 4 (22982)

T/C

0.267/0.733

21 DECR1_8

Intron 4 (22984)

C/T

0.267/0.733

22 DECR1_8

Intron 4 (23070)

T/C

0.271/0.729

23 DECR1_8

Exon 5 (23201)

A/C

0.271/0.729

24 DECR1_8

Exon 5 (23262)

A/G

0.479/0.521

25 DECR1_9

Intron 5 (25760)

C/G

1.00/0.00

26 DECR1_11

Intron 5 (30149)

G/T

0.042/0.958

27 DECR1_12

Intron 6 (36064)

T/A

0.30/0.70

28 DECR1_12

Intron 6 (36115)

A/G

0.917/0.083

29 DECR1_12

Intron 6 (36184)

C/T

0.955/0.045

30 DECR1_13

Intron 6 (36538)

C/T

0.188/0.812


Table 2. Sequence variations Hanwoo in MC4R gene

SNP number and primer for detection

Location in DECR1 gene

Variations in Korean cattle

(Hanwoo) in this study

Sequence

Frequency

1 MC4R_3

709

G/A

0.646/0.354

2 MC4R_4

927

C/T

0.75/0.25

3 MC4R_4

1069

C/G

0.354/0.646

4 MC4R_5

1343

C/A

0.938/0.062

5 MC4R_6

1786

C/T

0.667/0.333

 

Table 2. Sequence variations Hanwoo in NPY gene

SNP number and primer for detection

Location in NPY gene

Variations in Korean cattle

(Hanwoo) in this study

Sequence

Frequency

1 NPY_1

3814

G/A

1.000/0.000

2 NPY_1

3869

C/T

1.000/0.000

3 NPY_2

5531

C/G

0.947/0.053

 

Table 3. Sequence variations Hanwoo in CRH gene

SNP number and primer for detection

Location in CRH gene

Variations in Korean cattle

(Hanwoo) in this study

Sequence

Frequency

1 CRH_2

234

A/C

0.789/0.211

2 CRH_2

269

G/A

0.789/0.211

 

Table 4. Sequence variations Hanwoo in POMC gene

SNP number and primer for detection

Location in POMC gene

Variations in Korean cattle

(Hanwoo) in this study

Sequence

Frequency

1 POMC

7217

C/T

1.000/0.000


Table 5. Nonsynonymous SNPs and their frequencies found in Hanwoo in this study

SNP position

Amino acid change

Frequency in Korean cattle (Hanwoo)

A23262G

Val161IIe

0.479/0.521

 



- Equipment
 


-Equipments

- ND-1000 (NanoDrop; Thermo-Fischer Scientific, USA)

- 9700 Thermal Cycler (Applied Biosystems; USA)

- 3130 Genetic Analyzer (Applied Biosystems; USA)

3. Procedure


3. Procedure 

1) DNA extraction using Genomic DNA Extraction Kit (BIONEER Cooperation, South Korea) from hair root sample.

2) Use the ND-1000 for concentration and purity measurement

3) Primer production for areas where variations are expected.

4) Run polymerase chain reaction with 9700Thermal Cycler (;Applied Biosystems ; USA) respectively

PCR Composition
Template DNA1 uL
Forward Primer0.3 uL
Reverse Primer0.3 uL
dNTP1.2 uL
10X Buffer2 uL
Taq Polymerase0.1 uL
Total Volume20 uL


PCR Condition
Pre-Denaturation94℃5 min1
Denaturation94℃30 sec35
Annealing
30 sec
Extension72℃30 sec
Final Extension72℃5 min


Sequencing the PCR product with 3130 Genetic Analyzer (Applied Biosystems; USA) is performed to check the SNP

4. Results


4. Results

- Results Image

 40 SNP were found in a total of 4 genes

- interpretation of results

- Analysis of each SNP using DNA STAR program.

- Additional analysis of economic traits and relationships using SNPs in genes is required

- In the future, DNA Maker combinations can be created to develop DNA molecular markers related to economic traits.

▶ Distribution of genotypes and alleles for each gene

Table 1. Distribution of genotypes and alleles for DECR1 gene in this study

SNP position

Genotype

Frequency

Allele

Frequency

T5624A

TT

0.267

T

0.633

TA

0.733

A

0.367

AA

-

T5634A

TT

1.00

T

1.00

TA

-

A

-

AA

-

T5636G

TT

-

T

-

TG

-

G

1.00

GG

1.00

C5658T

CC

-

C

0.50

CT

1.00

T

0.50

TT

-

A17651T

AA

1.00

A

1.00

AT

-

T

-

TT

-

G17652A

GG

1.00

G

1.00

GA

-

A

-

AA

-

G18240A

GG

-

G

-

GA

-

A

1.00

AA

1.00

T18243C

TT

-

T

0.50

TC

1.00

C

0.50

CC

-

A18251G

AA

-

A

-

AG

-

G

1.00

GG

1.00

A18261T

AA

-

A

0.50

AT

1.00

T

0.50

TT

-

C18318T

CC

1.00

C

1.00

CT

-

T

-

TT

-

 

SNP position

Genotype

Frequency

Allele

Frequency

G20788A

GG

0.25

G

0.479

GA

0.458

A

0.521

AA

0.292

G20796C

GG

0.125

G

0.271

GC

0.292

C

0.729

CC

0.583

A20830G

AA

0.125

A

0.271

AG

0.292

G

0.729

GG

0.583

C20986T

CC

0.125

C

0.271

CT

0.292

T

0.729

TT

0.583

A21053G

AA

0.125

A

0.271

AG

0.292

G

0.729

GG

0.583

G21093A

GG

0.125

G

0.229

GA

0.208

A

0.771

AA

0.667

T22982C

TT

0.133

T

0.271

TC

0.267

C

0.729

CC

0.600

C22984T

CC

0.133

C

0.267

CT

0.267

T

0.733

TT

0.600

G22991C

GG

0.864

G

0.875

GC

-

C

0.125

CC

0.136

T23070C

TT

0.125

T

0.271

TC

0.292

C

0.729

CC

0.583


SNP position

Genotype

Frequency

Allele

Frequency

A23201C

AA

0.125

A

0.271

AC

0.292

C

0.729

CC

0.583

A23262G

AA

0.292

A

0.479

AG

0.375

G

0.521

GG

0.333

C25760G

CC

1.00

C

1.00

CG

-

G

-

GG

-

G30149T

GG

0.042

G

0.042

GT

-

T

0.958

TT

0.958

T36064A

TT

0.300

T

0.300

TA

-

A

0.700

AA

0.700

A36115G

AA

0.917

A

0.917

AG

-

G

0.083

GG

0.083

C36184T

CC

0.909

C

0.955

CT

0.091

T

0.045

TT

-

C36538T

CC

0.083

C

0.188

CT

0.208

T

0.812

TT

0.709

 

Table 2. Distribution of genotypes and alleles for MC4R gene in this study

SNP position

Genotype

Frequency

Allele

Frequency

G709A

GG

0.292

G

0.646

GA

0.708

A

0.354

AA

-

C927T

CC

0.625

C

0.75

CT

0.25

T

0.25

TT

0.125

C1069G

CC

0.208

C

0.354

CG

0.292

G

0.646

GG

0.5

C1343A

CC

0.875

C

0.938

CA

0.125

A

0.062

AA

-

C1786T

CC

0.417

C

0.667

CT

0.5

T

0.333

TT

0.083

 

Table 3. Distribution of genotypes and alleles for NPY gene in this study

SNP position

Genotype

Frequency

Allele

Frequency

G3814A

GG

1

G

1

GA

-

A

-

AA

-

C5531G

CC

1

C

1

CG

-

G

-

GG

-

C3869T

CC

0.895

C

0.947

CT

0.105

T

0.053

TT

-

 

Table 4. Distribution of genotypes and alleles for CRH gene in this study

SNP position

Genotype

Frequency

Allele

Frequency

A234C

AA

0.631

A

0.789

AC

0.316

C

0.211

CC

0.053

G269A

GG

0.631

G

0.789

GA

0.316

A

0.211

AA

0.053


Table 5. Distribution of genotypes and alleles for POMC gene in this study

SNP position

Genotype

Frequency

Allele

Frequency

C7217T

CC

1

C

1

CT

-

T

-

TT

-

5. Precautions


5. Precautions 

- Need to increase the number of the population as sample

- Need to add correlation analysis with economic traits




The original author's post (korean) ↗


1 0